Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14712E9
Clone ID IST14712E9
Vector VICTR76
Project tigm

Sequence tag IST14712E9HMR1
Sequence
TGAGGTTGGTCTTGAACTCCTATGTAGCCCTGGATGTGCCACTATGCCTGGCTATATACAGTACTGGGGATTCAAATCAG
GGTTTCAGTCATCTTAGGCAAGCATTCTAGCACCTGAATGATATCAGCAGACTCTAAAGACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34378653..34378798 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]


Sequence tag IST14712E9HMF1
Sequence
AGACCTTGTGTCAATAACATTATAACATCTATGATTTCAATAAATGACATGTCTGTTTTTTCTAAATGACCTTAAAAGAT
TCTGTTATTTCCCCTAGCTTGAGAGCACCCATCAGTCTTACTTCCCCTCTACATACCAGTCCACCCCTCCTTTATAGCAA
AAATATTAATTTTTTTCTTTTTTTTGAAAGGTTCTATATTTTATTACTGGACAAACATCCTAATTTAAGACACGAAAAGT
CTCCAGGTTTAAATGTTGAAATCCATCTGGTAGGACTGATTGATGACAATTCAGTATAAATCCTCAGTCTTGCNNNNGNG
TGAATCCTTACAGACCCNGCTTCGTTCTCNNNNNNTGTCTTCTCTTANGAGTTGTACCTGANTTTGTTGCCNANTNNNAN
CCGGATCCNCTGAGGANNNGNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14712E9BBF1
Sequence
AGACCTTGTGTCAATAACATTATAACATCTATGATTTCAATAAATGACATGTCTGTTTTTTCTAAATGACCTTAAAAGAT
TCTGTTATTTCCCCTAGCTTGAGAGCACCCATCAGTCTTACTTCCCCTCTACATACCAGTCCACCCCTCCTTTATAGCAA
AAATATTAATTTTTTTCTTTTTTTTGAAAGGTTCTATATTTTATTACTGGACAAACATCCTAATTTAANACACGAAAAGT
CTCCAGGTTTAAATGTTGAAATCCATCTGGTAGGACTGATTGATGACAATTCAGTATAAATCCTCAGTCTTGCCNTTGTG
TGAATCCTTACAGACCCAGCTTCGTTCTCCTCCAGTGTCTTCTCTTAAGAGTTGTACCTGANTTTGTTGCCAATTTNCAT
CCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34378805..34379211 399
 
EST/CDNA Est Name
  BE635003.1 - BE634657.1 - BF661102.1 - BQ033400.1 - BE447586.1 - BQ033803.1 - BE447319.1 - AU042867.1 - BE447473.1 - BF228185.1 - AI449325.1 - BM508443.1 - EH096109.1 - BG084847.2 - EH111924.1

 
Come back to gene BE635003.1 - BE634657.1 - BF661102.1 - BQ033400.1 - BE447586.1 - BQ033803.1 - BE447319.1 - AU042867.1 - BE447473.1 - BF228185.1 - AI449325.1 - BM508443.1 - EH096109.1 - BG084847.2 - EH111924.1


For any suggestions or comments, please send an email to unitrap@crg.es