Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14728F6
Clone ID IST14728F6
Vector VICTR76
Project tigm

Sequence tag IST14728F6HMR1
Sequence
GTGGAGTAAATAAAAGTGCCACATTCATTTATAACCCTATTACCTAACTTCCCAACCAAAAGTGTGAGATAAACTAGGTG
TGGTGCCAAACTCTTTTAATCCCAGCACTTGGGAAGCAGAGGCAGGGGGAAGAGCTCTGTGAGTTCAAAGCCATCCTCAG
CTTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103748389..103748553 165
NO GENE  


Sequence tag IST14728F6BBF1
Sequence
CCACGATGGTAATCTTTAAGATGCAGATTGTGGGGGAGTGGGGGGGGGGANNNGNCC
Sequence Type genomic DNA
Unitrap ID UNI32032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103748344..103748392 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]


Sequence tag IST14728F6HMF1
Sequence
CCACGATGGTAATCTTTAANATGCANATTGTGGGGGAGTGGGGGGGGGGGAGN
Sequence Type genomic DNA
Unitrap ID UNI32032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103748341..103748392 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es