Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_367G9-3
Clone ID CMHD-GT_367G9-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_367G9-3
Sequence
AGCTTCGATATGATCTACCAGCATTATACAACTTTCATAAAAAGAAATCTGTGGACATCGAAGTGGACCTAATTCGCTTT
TCTTTTTAAAAGCTTCTGAAGACAAAAAGCAGCTTAAAATCTAACTAAGGAATAAAAACACTGCTTACTAAATAAACTAC
TTGTCTCT
Sequence Type mRNA
Unitrap ID UNI12780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69709256..69709838 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es