Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12122D7
Clone ID IST12122D7
Vector VICTR76
Project tigm

Sequence tag IST12122D7BBF1
Sequence
CCCGCGCCCCCCGCGACTGACATGATGTTTCCGCAAAGCCGGCACTCGGTAAGGGGAACCCCGCGCACTGCACCCCAGNG
CTCTCCCTGCACCCCCAGCTCAGCTCACTGCACCTCCGGCGCTCACCCTGCACCCCAGCTCATCTCACTGCACCCCTTCT
AGGTCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33388

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81022366..81022535 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054452 (Aes) NM_010347 amino-terminal enhancer of split Gene [Source:MGI Symbol;Acc:MGI:95806]

 
Come back to gene ENSMUSG00000054452


For any suggestions or comments, please send an email to unitrap@crg.es