Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_367F6-3
Clone ID CMHD-GT_367F6-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_367F6-3
Sequence
GATCTACTACAAGTGACCATCTGCAACACAAATCACAAAGTTCATAAAAGAAACATGTTCAACAATGCAGTTGTTGTCAA
ATACAAACCTTGTTACTATACTACACTGTTATCTTGTTCTCTACAATTCATGACTTATGTACCAGAGTACACACCAGTTA
TATATTGCCAAGAATTAAGACCATAGAGACTGAGTAGATGGAAAATGCCTAATTAATACATATATTCTTGTGCCTCATAT
TTCACCACAAGTACAGTGTACTGTTAGTAGTCCAAAACTGCTTTACTTTTGTAAAAACACTGGTTAATTTGTATAAGATA
TTATATAGCTTTTTATGCTTTAGAGATTAAATATCATGGGGGAAACTAATTTATTTTTGTCACTTCTAGATGGTGGTACC
TCTTATAAAATGTTTGGGGGTAGTTTGATGTCATTTCTTCTTTTAATCAAAAGCCTATTCACAAAGTGGGATATATAGAT
GGATAAATATTTAGGCTGAAAGAATTTAACTTTTATCTTTACCTTGTTTTGGCTAATTGGAAAGGTTTCTAAGAAGTTTT
GTTCATTTTCTGATCATTTAAAATTCCTGTTGATTTTCTTTGTGCTTGAAAGGAATAAAATCTTTTTATCCAAACTGGTT
TCCCC
Sequence Type mRNA
Unitrap ID UNI5443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31254176..31254819 635
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047714 (Ppp1r2) NM_025800 protein phosphatase 1, regulatory (inhibitor) subunit 2 Gene [Source:MGI (curated);Acc:Ppp1r2-001]

 
Come back to gene ENSMUSG00000047714


For any suggestions or comments, please send an email to unitrap@crg.es