Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14688B5
Clone ID IST14688B5
Vector VICTR76
Project tigm

Sequence tag IST14688B5HMF1
Sequence
CCATAAGTGTTGGCTAATTGCTTGATTTGAGAGGAAATAGCTGATGTGTTCATCTGAGCCTGGTTAAATCTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59531623..59531699 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST14688B5HMR1
Sequence
ATGGCAGTTTAAAATGGACAGAGAACATTCCACAATACTCTCGATNACGAGAAATGCATCAAAATTCACTGAAATTCTGG
ACGGCATCAGGCAATTAGATATCTGCGAAGAGCCTGGCGCATTTCCTAACATCCCTCACATCTACACTCAAATTAATCCA
AGAATGTCAAGCCNNTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59531454..59531626 171
NO GENE  


Sequence tag IST14688B5BBF1
Sequence
CCATAANTGTTGGCTAATTGCTTGATTTGANAGGAAATAGCTGANGTGTTCATCTGANCCTGGTTAAATCTGTCAACAAA
TACTGANAACAGAGTGGGTGCAGAGCCTGTCTTCTGGCGTCTGTTTGTATCTGACATAAAGTAAACACAGTCCCTGCCCT
CTGCTTGGAGGTTGTCTCAATGCTGCATAGACAGCCGCATGTCCCTGCAGAGGCAAGCCCTTTANAGCTTGTGTTANTCC
ATGACTTGTANTGATTGACAACTGTGATGAGTTTTACTTTTTGAAAATTTCTCTTTGATTTCCTANGATGTTCNGN
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59531623..59531935 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es