Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11861A8
Clone ID IST11861A8
Vector VICTR76
Project tigm

Sequence tag IST11861A8BBF1
Sequence
GGAGCTGAGACGAAAGGATGGACCATCTAGAGACTGCCACACCCAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33394 UNI33395

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 73682694..73682744 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 109510366..109510416 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021699 (Pde4d) NP_035186 phosphodiesterase 4D, cAMP specific Gene [Source:MGI (curated);Acc:Pde4d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3732630..3732680 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041624 (Gucy1a2) NM_001033322 guanylate cyclase 1, soluble, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:2660877]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 24858874..24858924 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 117874602..117874652 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 101892302..101892352 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 104328846..104328896 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 36319208..36319258 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58053585..58053635 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 85533070..85533120 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 81195926..81195976 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 19252194..19252244 51
NO GENE  


Sequence tag IST11861A8HMF1
Sequence
GGAGCTGAGACGAAAGGATGGACCATCTAGAGACTGCCACACCCAGGGATCCATCCCATAATCAGCCTCCAAACACTGAC
ACCATTGCATATGCCAGCAAGATTTTGCTGAAAGGACCCTGATATAGCTGTCTCTTGTGAGGCTATGCCGGTGCCTGGCA
AACACAGAAGTGGATGCTCACAGTCAGCTATTGGATGGAGCACAGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 162850676..162850881 206
NO GENE  

 
Come back to gene ENSMUSG00000041624


For any suggestions or comments, please send an email to unitrap@crg.es