Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14731G2
Clone ID IST14731G2
Vector VICTR76
Project tigm

Sequence tag IST14731G2HMF1
Sequence
ATTCATGTGTATATCATTGTATAGGAAGTGCTGTCTGTGCTGTAGCCGCCTCCCCCCTCTCTTTTTCTGTGTGTGTGTGT
AGCCATGTGAATGAACCCTCCTGCCATGCACAACTGGGGTGAAATGAGGAAGGATGTGCCGAGGTCAGTANTCTTGGGTC
TTTTGTGTAGCAAGAGGCAGGACTAATTACAGGAGCAACAGCAGGGTGAAGAGACCACATGAGTCAGGGTATATTGGCAG
GCACCTCTTGGCAGATCGAAGCTGCTTGTTGGAACCTANTTGGAACTGGTTGCTGTGGTGATATCTACAGTGGGGGTAGG
GAATTGGGGGCNAGGCCNAGAGGCAAGANAATGGTGGGAGGTAGCTCAAGGACACACTAATAAAAAGCAAAGGGGGAATT
TTAGACCCTGGGTCAAGGCCAGAGTGGGTGGGTAGCCNAAATGGTGTGTTGATCCCACATGN
Sequence Type genomic DNA
Unitrap ID UNI33398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57932881..57933373 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037716 (Ccdc33) NM_029212 coiled-coil domain containing 33 Gene [Source:MGI (curated);Acc:Ccdc33-001]


Sequence tag IST14731G2HMR1
Sequence
AATGAGCCTGCACACAGGTCCTCATAAAGGCATGAATGTATAAGCACACATCTGCATCTGTGTAAAATCCCAGGTTAATC
CCCCCTCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57933371..57933460 90
NO GENE  

 
Come back to gene ENSMUSG00000037716


For any suggestions or comments, please send an email to unitrap@crg.es