Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14573C3
Clone ID IST14573C3
Vector VICTR74
Project tigm

Sequence tag IST14573C3HMR1
Sequence
CACACAACAAGTTCCAGGACTGCCANANCTACCCAGAAAAAAACTCTTTCTTTCTTCTTCT
Sequence Type genomic DNA
Unitrap ID UNI22418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173344944..173345004 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]


Sequence tag IST14573C3BBF1
Sequence
GTGTGGAGCAGGCTAACCTTGGATTCAGAGATAAGACTGCCTCTGCCTCCTGAGTGCTGAGATTAAAGGCATCCACCCCA
CCCCCCACCCCAGCACACCATCTTGATGCTAATAACAGTGACTAGCACCACAGTTTTATAGATAGAGAAACTAAATCACA
GAGCTGGTAAGTGTTGGAGCTGGGTACCTGAACCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173344748..173344948 201
NO GENE  

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es