Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13879G5
Clone ID IST13879G5
Vector VICTR74
Project tigm

Sequence tag IST13879G5BBF1
Sequence
AGCCCAGAACTTGCCCTATTACCTTTCATACTCATTCCTCAATCTTTGATACTACTGTTTTGGGTGCANACTGCAGCAGT
TGAAAGACACTAGGGTGACCCCTGGGGACCCACAGACCTANCANAAGTCAGGTTCTAGCCCAGTGGCTCTTATAGAAATT
CATCTTGCGCCTGTCCGGCCTCCCATCCGCTTTGGCCCCCAAGGGCGCATGAAGGGGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7342116..7342338 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024968 (Rcor2) NM_054048 REST corepressor 2 Gene [Source:MGI (curated);Acc:Rcor2-001]

 
Come back to gene ENSMUSG00000024968


For any suggestions or comments, please send an email to unitrap@crg.es