Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14841E5
Clone ID IST14841E5
Vector VICTR76
Project tigm

Sequence tag IST14841E5HMF1
Sequence
GCGGGGGAGCTTCAGGTTTGAGGAAGTAGTGTTTGGCCTGAGCTCCCTCCACAGGTGAGGAAGTGGAGGCCTGGAGAAGG
TATAAGTTGCCAGGGTTGCACAGTAGATCAGCATTTCCCCAGGACAACCCAGTGTGTCTTTCACCTGCTGCTGTATGTGT
GCTAGGCTGGCTGGGGGCTGGGCTGGGGGTTGGGCANGTAATACAAAGCCNNGATCTTAN
Sequence Type genomic DNA
Unitrap ID UNI15948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106649203..106649421 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061887 (Ssbp3) NM_198438 single-stranded DNA binding protein 3 Gene [Source:MGI (curated);Acc:Ssbp3-001]

 
Come back to gene ENSMUSG00000061887


For any suggestions or comments, please send an email to unitrap@crg.es