Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10407C7
Clone ID IST10407C7
Vector VICTR76
Project tigm

Sequence tag IST10407C7BBF1
Sequence
AGCACCAGAGAGTAGCTGTCCCAGGGCTCACCCTTCTTTCAGGACAGTTCAAAGTCTCTCAAGAGAATAAGATAGAAGAT
TCCTGAAATAACCAATAGCCACTTCCTTCAACCTCCAGCCCGTTGTGAACTATGGCCTCCCTTATGCTAGGTTCTCTGCT
CACACCCAATATTTTTGGAGGTCTGACTTAAGTGGTGCTGANTCTCTATGCCCTCCACCCANNTACCCTCTTTTCATGGT
TGAAAACTTGGGAGTTTTCTACTTCGGATTGCCTTACTATAAAATTAGAATTTTCCAAGGAATGGAGTATACTGATGCCT
GGGTGTAGACTACTTGTTTGGGGTTTGCATCCCTTCTCATCTTGATTCTCCTGTTCATTGCCAGGACAGGGGCACAAATA
CTGCTTAAATCCCCNAANCNATGCACAATGCTTAAATTTACCNAACTTTTTTTNAGACCCCCCCCCCNNNAAAGGNAN
Sequence Type genomic DNA
Unitrap ID UNI11918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37106648..37107122 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es