Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13351D5
Clone ID IST13351D5
Vector VICTR74
Project tigm

Sequence tag IST13351D5HMF1
Sequence
CTACCAATGGGCGGTGTTANAGTGGGAGATGCGCANACAATGAATGAGGGGGGAAAGGAGCCTTGGGGTGCACAGTGCAG
TTTGGGTGANATTTCTCTTTCCAGTTAGTTCTCCAACCTCAAGTTATTCATCTATGCAAAAGGGAGACGAGTTATTACTA
CTTCATAAAAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI31331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87439763..87439936 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST13351D5BBF1
Sequence
CTACCAATGGGCGGTGTTANAGTGGGAGATGCGCANACAATGAATGAGGGGGGAAAGGAGCCTTGGGGTGCACAGTGCAN
TTTGGGTGANATTTCNCTTTCCAGTTAGTTCNCNAACCCCAAGTTANTCATCTATGCNNAAGGGANACNAGTTATTACTA
CTTNATAAAANGTCAACGCNNGAAAACGTGGATCTGTCCGAACAATCTTTCAATCATGACCCTGTTGGTTTACAGCNCNT
NNAGGAAGGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es