Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14860G1
Clone ID IST14860G1
Vector VICTR76
Project tigm

Sequence tag IST14860G1HMR1
Sequence
GCAGNTAATGAGAAAAGGACCACCAAAGTCAGATGTAAGGCAAAGGCAACTTTATTTACCAGGGGAAAATGCTAACTGGT
TAGGTTCACAGTCAGTTTCTGAGCTGACAATATGACCCTGAAAGGGACTGAACAGTCTCTCTCTCTCTCTCTCTCTCTCT
CTCTCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI13002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17214330..17214498 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]


Sequence tag IST14860G1HMF1
Sequence
CTGCNTGCTTTATGACNCCNACATCCAACCTCAAGCTTGACAAGTCCCTGAGCAACAACCCATGGGTCCTTGCTGTCTTC
CATTTCCAAGTCCTCCAACTGCCTTCCTGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17214224..17214333 102
NO GENE  

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es