Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13612D3
Clone ID IST13612D3
Vector VICTR74
Project tigm

Sequence tag IST13612D3HMR1
Sequence
CTACCAGAGTTCACAGATGATCAAGCAGGCATGCCTGAGGAAGGTGGAGTGCTCTGACCTCACAGAGACCATATGGCGCC
TCCTCTGGTGGCCTGGTGGTCTACACCCATCCCTGGACAGGACCAGGAGGAAGAAGCTGGAGCCCCGGAATCTGGGTCCT
TGGTGGGGCTGAGAGGAGAGAGCATGTGGGCTGAATTGGGGCCTACTTGGAGCTTGGCAGGTTTGTTTTTTCTTTTGGGT
CAAGGCAAGGCAGAGAAGGAGGTAGCTTCAGGCTTGN
Sequence Type genomic DNA
Unitrap ID UNI31931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35471651..35471926 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]


Sequence tag IST13612D3HMF2
Sequence
CAAAAGTTATCATTTGGTAATGGCATATTTGTTGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 49937161..49937198 38
NO GENE  


Sequence tag IST13612D3BBF1
Sequence
GGCAAAAGTTATCATTTGGTAATGGCATATTTGTTGAGTTGACAAGATGTCAATTGTGTGTGTGTATGTGTGTGAAATGA
TAAAACTGATCATTTTTTGCAAAGGANAAACCACGGTTCTGAAATGCATACAACAGAAGGTACTGCAGGAAANCATGTAN
TGCAACTTCCTGCAAAATGATCGCTGTGGACACTGTGANCTCTCACATATGGGCAGGTGCTGCTGAGAANTATTAGANNG
ANGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 49937159..49937402 226
NO GENE  

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es