Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_368G4-3
Clone ID CMHD-GT_368G4-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_368G4-3
Sequence
TGAAGCTGGGAAAGACAAGAGCAACCCAGATGAGTTTGCTGTCGCTCTTGACGAGACTCTGGGAGACTTTGCCTTTCCTG
ATGAGTTCCTGTTCGACGTGTGGGGAGCCATCAGTGACATGAAACAAGGAAGATGATGGCGTGGCCCGTGTTCCTGCAGA
GATGACCACAGTTCTGCAGGCAGCCTTCTCCGGGGTCTTAGACACTGTTATGAACTCTACTTTAGCCTCTTGTGTATGAG
ATACAGTCTTCGAAATGTAATTTTGATTTATGGATGATGTTTAATATAGTTTCTTATGTAGTGTGTTTAAGGTAAATTAA
AGTGTGATCCATTTTAATATTTGTTCAAAAGCTTTAAAATTTTTAGAGGAATCTTTCTACATAGGTGATTTTGGTCCCTG
TTTGTACCCACGGCTCTTTCCACATAAAATACTTGATTACAAC
Sequence Type mRNA
Unitrap ID UNI12795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151756804..151757246 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039131 (Gipc2) NM_016867 GIPC PDZ domain containing family, member 2 Gene [Source:MGI (curated);Acc:Gipc2-001]

 
Come back to gene ENSMUSG00000039131


For any suggestions or comments, please send an email to unitrap@crg.es