Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10034D11
Clone ID IST10034D11
Vector VICTR75
Project tigm

Sequence tag IST10034D11HMR1
Sequence
GTTCTTTGCTAGTTCTTTAAATTGCATACTTGTTTGAAATTTCCTGAATTTTTTTCACATGTGTGAGTGTTTCACCTGCA
AGTATGTATGTGCACCAGGCGCCTGGGTCTTGTTGTTGTCAGAAGAAAGAGTTAGATCTTCGAAACTGGAGTTAAGAATG
ACTGTGAGCTATGTTCTTGGTGCTGGGACCCAAACCTGTGTCTTCTGCAAGAGCAGCAAGTGGCCTTACCTGCTGAGATG
TCTCTCTAGCTCCAAAAATCTGTTTCTGTTGATGTTAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI12754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100438297..100438577 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032475 (Nck1) NM_010878 non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI (curated);Acc:Nck1-001]

 
Come back to gene ENSMUSG00000032475


For any suggestions or comments, please send an email to unitrap@crg.es