Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922D1
Clone ID IST10922D1
Vector VICTR76
Project tigm

Sequence tag IST10922D1HMR1
Sequence
CTAGCTGGGATTTGGAACATAGACACCAGCATCAGGGAAACACGAGATCTGCTGCTGTCAAACTTTTCAAATGACTGAAG
TAACTCATTTCCAAAAATTTAAAATAACTCTTCAATTTCCTGCCATGTTTAAAAAAAAAAAAAAAANTN
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129648986..129649131 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]


Sequence tag IST10922D1HMF1
Sequence
CTAGAATATCAAGATCTAATNACAGAAGCACGAAGGCTGGGGCTTAGAGAAACACAATGAGAGCCGAGAAAGGGCAAGAC
GCATCAGACACGGTGCCAAGAATTCCTTCCACGGAGTGTTTGTTTGTGTGGTTGAGCTATAAGTCCACAAAGTCAAAGAC
TCCTCAAACATGAATTGTCTTTTGCTTTTCAACAGACGCCAACGTTGATTATGTGGTCAGGCAAGCAGACTTGCCTAGGT
CTAAGCTAACAACAGCCCAAAGCTAAAAGCTTTCCCAGGCACTTAGGGGAGTCTGCCTTCAAGGTTTGCCCTTCCNTGGC
CTGGGAGCGATGTCACACAGGGCCACAAAGCANAGTCACACCACTCCCGCAGCAAGCACAACCACAAGGCTATGGTTTGA
ACATCTGTGTGCTGTCTAAGAGTCTGGCTGAAATGTAATCCNNACAGCAACAACATTAAAAGAGAGAGAGTGTTTCCCAC
CGCCACCCTTTTTTTATNATTTGTTTTTNATNANCATATATTAAGTATN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129648462..129648989 510
 
EST/CDNA Est Name
  AV069303.1 - AI390866.1

 
Come back to gene AV069303.1 - AI390866.1


For any suggestions or comments, please send an email to unitrap@crg.es