Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14922B5
Clone ID IST14922B5
Vector VICTR76
Project tigm

Sequence tag IST14922B5HMR1
Sequence
CAGGGAGGTANNNNNNTNANNNNNNNNGNGTGCNNCNATGGTCAGCCTCTAGCACAGCATCCATTGTGCTGTCTTTGAGC
CTTANCTGCCTCACTTTG
Sequence Type genomic DNA
Unitrap ID UNI486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6013602..6013660 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14922B5BBF1
Sequence
CCTGTGTAATGAAGAACAGGGAGTATATATAGCCGTGACCATCAGCAAGTTCCTCTGGGGCTGGCCTTAAAATGGAAAAC
CATCAATCAGGACAGAGGCAGAAGGAAAGGTCANACAGAGGGGTCACTGCAAGGGCAGGCACCGTTCCCTTGACATTACT
CCTTTCCACTCGCGTGAAAGGAGACGTTTTANAGCCAGGCATCACCACCTAAAACAAAGATGACAGAATATATGCCCATC
ACTTGGCGGAAGATTGCTAGGGGGTGTTTTNTTAAATCTGCATGATCTANTCNNTANNTATTTNCNNNNGTCATGCNCCA
CTTTNGNNGNGCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14922B5HMF1
Sequence
CCTGTGTAATGAAGAACAGGGAGTATATATAGCCGTGACCATCAGCAAGTTCCTCTGGGGCTGGCCTTAAAATGGAAAAC
CATCAATCAGGACAGAGGCAGAAGGAAAGGTCAGACAGAGGGGTCACTGCAAGGGCAGGCACCGTTCCCTTGACATTACT
CCTTTCCACTCGCGTGAAAGGAGACGTTTTAGAGCCAGGCATCACCACCTAAAACAAAGATGACAGAATATATGCCCATC
ACTTGGCGGAAGATTGCTAGGGGGTGTTTTCTTAAATCTGCATGATCTAGTCAATAAATATTTGCCAAGGTCATGCTCCA
CTTTTGTTGTGCTGAAATCCACTGGGCGCTAATCANANNNTNNNGCCTTANGATACTTANTTGAGANTGNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6013695..6014083 369
 
EST/CDNA Est Name
  CD539677.1 - CD540754.1

 
Come back to gene CD539677.1 - CD540754.1


For any suggestions or comments, please send an email to unitrap@crg.es