Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_372H9-3
Clone ID CMHD-GT_372H9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_372H9-3
Sequence
CCAACCCCAACAAGACGAGGGCCTCCCTGTGGGCCTCTCTGCTATCCCAGTCCCCTGGAAAAACCTAGGCCCCAGC
Sequence Type mRNA
Unitrap ID UNI12800

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10101020..10101095 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024663 (Rab3il1) NM_144538 RAB3A interacting protein (rabin3)-like 1 Gene [Source:MGI (curated);Acc:Rab3il1-001]

 
Come back to gene ENSMUSG00000024663


For any suggestions or comments, please send an email to unitrap@crg.es