Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12548G11
Clone ID IST12548G11
Vector VICTR76
Project tigm

Sequence tag IST12548G11HMF1
Sequence
GCAGGAGCCCAGNTATGTGATAGGAGAAAAGGACTGACTCCAGGGACGCACACACACACAACTGGACACTGGTAGTGGTG
GTTGTTTAAAAATAAGTAAATGGTTCTTANAGTGGAGAGGGTGAGANACTCCACTTACTGAGTGGAGTCTTGCATTTACT
ACTTGGGCATTTTGTTGGGTCTTTTAAGGATTCACCTTGTAATGGTGCTGCCTCGGATGAGGTTAGCTTTCTGGATTTTG
CTGGATTATGTTATTAATGTTATAGGGTAATGTGTTACTTGCCCTTCACATTGTCTTATTANCANAAACCACTTCTTCAN
GTAAAGAGGCATGTCTGTGTGTGTTCTGTNNNAATTATTTATGTN
Sequence Type genomic DNA
Unitrap ID UNI33410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 144097703..144098066 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040151 (Hs2st1) NM_011828 heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]


Sequence tag IST12548G11BBF1
Sequence
CATGGATGTTACAATGGCGCCGCAAGTGGCTGGACCGTTTGAAGGTCTTGCCGCAATCTTTGCACACGTGTGGCTTCAAT
TCTGAGTGTGANATGCTGTGGCNCTCCAGGTCANANAGGTAGGGGAAGGCTCTCAGGCACACGGGACAGAAGTGCGGANC
CCTCTTGGAACCAGANCCCTGGGGCCCATCTGCTGCTGACCCTTCANGAACTGTATAAGGAACACCCTGATCATCGATCA
ACANAANANCGCTGCTGCCNCCGCTGTCCACTGGTGCTGTCAACGGGGTTTCCTGCTCTGATCTGGGGGGACNGCCCCTC
TTTCNANGGANGNANGANTTGANANTCCNANTNGANNNGTGGCTCCCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040151


For any suggestions or comments, please send an email to unitrap@crg.es