Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0611
Clone ID BC0611
Vector pGT2lxr
Project sanger

Sequence tag BC0611
Sequence
CTCACTTCCAGAACCTGGATCACAGCAACAAACATTTGCGGTCCCCCGGCCACCACATCAGCCCCTGCAAATGCCAAAGA
TGATGCCTGAAAGCCAGTATCCATCAGAACAGAG
Sequence Type mRNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22411706..22411819 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 71167037..71167150 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044690 (AC127224.3)  

 
Come back to gene ENSMUSG00000044690


For any suggestions or comments, please send an email to unitrap@crg.es