Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11189B8
Clone ID IST11189B8
Vector VICTR76
Project tigm

Sequence tag IST11189B8HMR1
Sequence
GTAAGTACACTGTAGCTGTCTTCCGACACTCNAGAAGAGAGAGTCAGATCTCATTACAGGTGGTTGTGAGCCACCATGTG
GTTGCTGGGATTTGAACTCCA
Sequence Type genomic DNA
Unitrap ID UNI29342 UNI30995 UNI30996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138929..38139029 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23000036..23000136 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040420 (Cdh18) cadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1344366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379679..82379779 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053302 (AC124384.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UWJ8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 125067596..125067696 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705604..25705704 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143651983..143652083 99
NO GENE  

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es