Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14582G9
Clone ID IST14582G9
Vector VICTR74
Project tigm

Sequence tag IST14582G9HMF1
Sequence
GTGTCTGAGCCGCGGGAAGGATGTGGCCTGGCATATAGCTAGTGAGTCTCAGTTTCATTTTCTGCAGCGGTGGTTCAAAA
GTACAACCTGAGATGCTCAGGGCTATCGGGCATAATATTTAATTGCCACTGTCTGCTCTATAATGAGGCAACAAAGCAGG
GCCCACCCTGTTCCCTGGGTTTTAGTTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI33417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12948588..12948779 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


Sequence tag IST14582G9BBF2
Sequence
TTATAAAACTTGTGTGCCCGAGGCCCCACGACGACAGACGGAGCCACACTGCTTGCCCAGGTCTCCCACCTCATTTGCTG
CCCATCTTCCCTTTCCCTGACTCCAAGGAATTCAGGGAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95508841..95508959 119
NO GENE  

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es