Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11018F1
Clone ID IST11018F1
Vector VICTR76
Project tigm

Sequence tag IST11018F1HMF1
Sequence
AGACAAAATCCAGTAACAAATGGACACTGACTGCAGTCTAGGACAGCACAGCTTCCGGGTACTGTGTGCACGTGGCAGCG
GGGAAGGGCAGGGTTCGCGGCCCAACTCAGCTTCCGTAGGACTGGCCCCGCCCACAGCGGAAGTATGGGCGGGACCCGTA
GGTCGTGTGCGTCCAGCGACCGGAAGTAGCTGTTGGGCAGCTTTCGGACGCTTTAAATTCCTGCGGGGTGGAGGGCTTAG
CTTGGGTGCCCGGGTCTGGTTTCTCACTCGCATGGCTGTGGACGTGAAGTCTCGAGCGAAGCGCTATGAGAAACTGGACT
TCCTCGGANAGGGACAGGTGAGGCCTGGGGCTGAGTTCTCGCGCAGGCAGGCACAGCCTGGA

Sequence Type genomic DNA
Unitrap ID UNI11714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101500685..101501065 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es