Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10034B4
Clone ID IST10034B4
Vector VICTR75
Project tigm

Sequence tag IST10034B4HMR1
Sequence
CCTTCCCCACCCCCAACTTGTTTTCTAACAGTATTATGTTTTCNATAGACCTGCTTGGGTGGGAATTTGGACTTTGTTCT
TTCAAAGTAGCTCCAGTCTTTTTTTCTATTTTGTAGGCTAAACCTTGACTTANAAAATGTGGCCTAGATAGTTTAGTTTT
ATTATTTTCCTTTGTTGAGATCTAGACTTATAGTTTTGTACTTAATGAGCTTAATCTTTTTTTTTTTNAN
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649378..66649604 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es