Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_374F12-3
Clone ID CMHD-GT_374F12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_374F12-3
Sequence
TTGCAGAACATTTAAAAGATGCCTCGAAGAAGAAGAAGAAGAGCAGCCTCCTGTTCGTAAAGCTGGCCAACCCGCACTCA
GGGGAAGGAGCCACATACTTAATTGATATGTGTCTTCAACAGCTGTTTGAAATAAAAGTTTTCAAGGAAAAACACCATTC
TTGGTTTATAAATCAATCAGTTCAATCAGGGGGCCTTCTCCACTTTGCCACACCCATGGATCCATTGTTCCTGCTCCTTC
ACTATCTCCTAAAGGCTGGCAAAGAGGGGAAGTATCAGCCCTTGGACCAAGTCGTGGTCGATGACACGTTTCCAGATTGC
ACCTTGCTGCTGAGATTTCCTGAGCTTGAAAAGTCACTTCGGCATGTGACAGAGGAAAAAGAAGTGAACAGCAAGAAGTA
CTATAAGTACAGCTCAAAGAAGACATTGAAGTGGCTGGAGAAGAAGGTCAACCAAACTGTGGTGGCACTAAAAGCTAATA
ATGTCAATGTTGGAGCCCGGGTTCAGTCATCTGCATATTTCTCTGGTGGTCAGGTTTCCAGGGACAAGGAAGAGGATTAT
GTTCGCTATGCCCATGGTCTGATCTCTGATTACATCCCTAAAGAACTGAGTGATGATTTATCCAAGTTCTTGAAGCTTCC
AGAACCTCCAGCTTCATTGACCAACCCTCCATCAAAGAAACTAAAGTTATCAGATGAGCCTGTAGAAGCC
Sequence Type mRNA
Unitrap ID UNI10404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62965399..62989341 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]

 
Come back to gene ENSMUSG00000021932


For any suggestions or comments, please send an email to unitrap@crg.es