Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10494E1
Clone ID IST10494E1
Vector VICTR76
Project tigm

Sequence tag IST10494E1HMR1
Sequence
NGNCCTCCTTACCTCTGATTCTGGGTGTATTAGAACCCCGGGAGTGGAGCTTCCTCTGGGTGTTGTGGGACTGGATGTGA
GTTTACGCCCAAGGTCTGCTCCCTGTTTTACAAGTTATTGTGAAGATTGAAAAAAGCTTCCAGGACTGTGTCTGGAATCT
AGTAACACGTCCATATTGATAAT
Sequence Type genomic DNA
Unitrap ID UNI5617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3426150..3426329 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025898 (Cwf19l2) NM_027545 CWF19-like 2, cell cycle control (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918023]

 
Come back to gene ENSMUSG00000025898


For any suggestions or comments, please send an email to unitrap@crg.es