Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14012D2
Clone ID IST14012D2
Vector VICTR74
Project tigm

Sequence tag IST14012D2HMR1
Sequence
NCTTTGTATCTTTGATTCTGGGGCCTGTGGAGAGGAATGACTGTATCCNTTGGTTCTTGAACTACTTTTCTTTTTTTGTA
NCGTGCTATCANTATTCCTGAACCCATCTTTGTCCTTCTCTTTTGGAANCCTGANCCAGGTGCTGTCAGCCCCATAGTCA
CAAGTTCATCTGAAACCAATGTCACTGGACAGTCTGTGGAAGAAGAACTTGTCCCTTGGAAGCAAACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI19444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 137554640..137554869 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009418 (Nav1) NM_173437 neuron navigator 1 Gene [Source:MGI Symbol;Acc:MGI:2183683]


Sequence tag IST14012D2HMF1
Sequence
ATTACNATTCATAATGGTTGCAAAACTANTTATGAAGTGGAATTGGGGAGTGTCACCAAAAGTACTTGGGATGGTTTGTT
ANCCTTTATCTANTGGGAANANTTTCCGGCCNCNGGTTGATCGGATTACNNCNCTGGGCCNTGAATTTGGTTCCCATTTT
GTCCNGGCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000009418


For any suggestions or comments, please send an email to unitrap@crg.es