Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14837G8
Clone ID IST14837G8
Vector VICTR76
Project tigm

Sequence tag IST14837G8HMF1
Sequence
ACATACATACATACATAAGAAAGCATTGGAAGCATGGGTTATGATCTAGAACCAGTAAACCAGAGGGAGATGGAGATTTG
CCAGTCTGGGTTCTAGAGTTACCAATGACTTTTCTGTCTGTTATCAGCTCTTGTTCCCTTCAAAATTGAAAAGAGACATG
ATTTTCGGTAGACAGTACCAGTCCTTCAAGAAAAAACAAACAAACAAACAAACCCACATGCATAAGTGTCTCTCCTTGTT
TGGGGCGCTTTTTTGTCTTGCAGGGGAATGCCATACTAAAACTTCCCCCCNAANACTTTANTGGGAANAANTTNNNAATT
AT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 10293261..10293581 305
 
EST/CDNA Est Name
  BY229306.1 - AA915366.1 - BY122480.1


Sequence tag IST14837G8HMR1
Sequence
NNATGTATGTATGTATGTATGTATGTATGTATGTATGGAGACACAGTCCCAGCCAGCCAGCCAGCTTGATTTGGAACGAC
AGCTACTCATCCTTCTGATTCANTGTCCCATGTTCTTTTAAACATGAAATAATGTTTGTTATCTGCCCCGTGGAGCTAAN
GANATCANTGGAAAGAAGAATGTAGATGGGAAACATGCATTGTGTAAACCTGACACATAACAATAACCTCANCCTTTCTC
TTCTTATGCCCANATTTGAAAACTTTTCCACCCTCTGTTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI33418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 10292984..10293264 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073288 (AL671335.12) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UUN3]

 
Come back to gene ENSMUSG00000073288


For any suggestions or comments, please send an email to unitrap@crg.es