Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10728D10
Clone ID IST10728D10
Vector VICTR76
Project tigm

Sequence tag IST10728D10HMR1
Sequence
TCGTACTGCTCACTGGTTAAACTTTCCCAAGAACACTCGCTCCTATTGCTTCTCTTTCCTTTCCAACTCTCANACTTGTT
C
Sequence Type genomic DNA
Unitrap ID UNI11806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22323366..22323445 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]


Sequence tag IST10728D10HMF1
Sequence
CGACNAATACACACTCTAGTGCTCTANCAAGGGTAACCACACAGCTCTTCATTCAAAGCCAAAAAGGTTGATTATGCTGA
GACAACAGATATAGAGCAGAGCATGAGGCGGCCCTGCCTATAAACCAACAATGCAACTCTACGTTCAAGAAATGTGTACA
CATGTGCATCACGATATGTATGTTGAGATGCTTCAAGCAAACCAAAAACAACTAAAATACTCANCAACAACAGAAGAGAC
CATGAAAATTATGTNCNTNTGCCNTAAATCTTCTATCGAAAGTTTACTATTCTTACTACNACCCACCTTCCTACNTNTCC
CCAAACCAACTGACTTTTCTAGATACAAATGTAGCNNTTGCTCTGTATGTGGAAATCAAAGGCNNATTACTCACNAAACT
AGCTNAGAAACTACNAGCCAGANACTTGGTNNAAACTTTTCTAACAGGGAAATGANATGTCTNAGAAANGTGCAGNGACN
NGGCTCACATNAGTAAATGCNCTTNNTGATAAATCTGANTTNGATACNNNGNANCCCNNGTNGNNNANNAAATCAGANCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es