Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_372C12-3
Clone ID CMHD-GT_372C12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_372C12-3
Sequence
CCGTTGTGAAGTGCACGCTCCTTACCCGGTGCACGTGTACTGGCTGCTCAATGGGGTGCCTGTCCAGGACACCGAGCGAC
GGTTTGCCCAGGGCAGCAGCCTGAGTTTCGCAGCTGTGGACCGGCTCCAGGATTCCGGTGCTTTCCAGTGTGTGGCTCGG
GATAACGTCACTGGAGAGGAAGTCCGCAGTACTAATGCCTCCTTCAACATCAAATGGATCGAGGCAGGTCCTGTGGTCCT
GAAGCACCCAGCCTCAGAAGCTGAGATCCAGCCCCAGACCCAGGTCACACTGCGATGTCACATTGACGGGCACCCTCGGC
CTACCTACCAGTGGTTCCGAGATGGGACCCCCCTCTCTGATGATCAGAGCACCCACACCGTCAGCAGCAGGGAGAGGAAC
CTGACCCTACGGCCAGCC
Sequence Type mRNA
Unitrap ID UNI1307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46727301..46728678 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023972 (Ptk7) NM_175168 PTK7 protein tyrosine kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1918711]

 
Come back to gene ENSMUSG00000023972


For any suggestions or comments, please send an email to unitrap@crg.es