Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14700D12
Clone ID IST14700D12
Vector VICTR76
Project tigm

Sequence tag IST14700D12HMR1
Sequence
AATGAACGGTGGCTGGGTACCTTTCTGAGTATTATTTCATCTTTAAACTTATTACCCCGACATGTTTGTGGGGAATCGTT
CTATTACATACGTCTAGGCACTCAGTTTTAAACAGTTAAGTTTAGGTAAAAGTTACTTCTTGATGTATACTCACAGACTT
GTATGATCTCTTAAGTGGGTAAAATATACAAGTAAAAAGCTGCTAT
Sequence Type genomic DNA
Unitrap ID UNI15611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53984277..53984482 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es