Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14276H5
Clone ID IST14276H5
Vector VICTR74
Project tigm

Sequence tag IST14276H5BBF1
Sequence
AAGGTCCTGAGTTCAAATCCCAGAAACCACATGGTAGTTCACAACCACGCATAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104169723..104169785 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14276H5HMR1
Sequence
CCCCCAGCCTCACACAGTTACGAGTTTGGGGGTGCTTGGCTTTGTTTGGATGCAGGGATTCANCTCTGGGGTTCATGAGC
CTCAGGGCCCCAGGCAGGGACCCGCCCAGGCCTGTAATCCCAGGGGCAGAGCTGAGGCAGGGGGATGACTGANATGGCAG
GCCGGCCTGTGCTGGCAGGGCGGGAACCAAGCCCTTCCCCAGCCCGGGGGCTGCCTGGCCGCCTGCNTCNCCATGGCNAC
ANGNANGANACNCANANCCGCTCCCGCCAGGGGGTCATGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es