Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_374C1-3
Clone ID CMHD-GT_374C1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_374C1-3
Sequence
CGAGTACTTCAGGAATTTGCAGCTTGGCTGAAGAGGAGATAAAAACTGAGCAGGAGGTGGTGGAGGGAATGGATATCTCT
ACTCGCTCCAAAGATCCTGTCTCTACAGAGAAAACGGCCCCGAAACGGAAGTTCCCCAGCCCTCCACATTCCTCCAATGG
CCATTCGCCCCAAGACTCATCCACGAGCCCCAGT
Sequence Type mRNA
Unitrap ID UNI12801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165677550..165701281 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es