Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14902F2
Clone ID IST14902F2
Vector VICTR76
Project tigm

Sequence tag IST14902F2HMR1
Sequence
CTTTATCTTCTTCTTGATTGTGGAGAGTGCTTCAGCGTTTTTTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30936980..30937026 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14902F2HMF1
Sequence
AAAGAAAGCCACAAACACTACAGCTCTGGATACAAAGAGGTCACAGAGTGTGGAAGAAGATAAGAAAAATAAATACAAAG
TAGAAAGACAGAGGAAGTGGTAGGCTGACTACCACCAGTACAGGCCGGCTGCTGAAAGCCAAAACAGGGTCACCACAGGA
GGTTCCGGGCTCCAATANAGATAGAGATATGCAGCCTACATTCTAGCCATCCGAGAAGGAAGGCCTCAGAAACAGTGTTG
AAGGTTGCTGGGACTGCTACCCANCTACCCAGGCTCCCTGGAAGANCAGCCACTGCTCTCACACACCAAGCCACCTCTCC
AGTCCAGAATTTCANTTTGAGAGCCCACTGTCTANCCNAAGATGACTTCCCTCNCCTGACTGTCCGGCTTNCACNNNNAA
GTGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30937023..30937427 381
 
EST/CDNA Est Name
  CK636270.1 - CF535965.1 - CO431220.1 - DT919270.1 - CB523244.1 - CF744396.1 - BY090554.1

 
Come back to gene CK636270.1 - CF535965.1 - CO431220.1 - DT919270.1 - CB523244.1 - CF744396.1 - BY090554.1


For any suggestions or comments, please send an email to unitrap@crg.es