Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0324
Clone ID BC0324
Vector pGT2lxr
Project sanger

Sequence tag BC0324
Sequence
AGCCAGAAAATACAGAACTGGGAAAAACTATATTTGGCAAGTTTAAGACATATGGGAGATGGACATCGACAGGCTAAAGA
AAATGAACCTGACTTGGATGCTCTTTCTCGGCGTTTTGCTGAAAGAAAAAGAAAAGCAGAAGTGAGGCTTTTAGAAGCCC
TAAAAGTGCAGAAAA
Sequence Type mRNA
Unitrap ID UNI1986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15156169..15157426 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079706 (AC155259.1)  

 
Come back to gene ENSMUSG00000079706


For any suggestions or comments, please send an email to unitrap@crg.es