Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10099A11
Clone ID IST10099A11
Vector VICTR76
Project tigm

Sequence tag IST10099A11BBF1
Sequence
CCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCT
Sequence Type genomic DNA
Unitrap ID UNI12847 UNI26052 UNI26585 UNI31091 UNI31848 UNI33283 UNI33422 UNI33423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166291: 22519..22575 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 182324..182380 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 395433..395489 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053461 (Hhipl2) hedgehog interacting protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:1926022]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3752002..3752058 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3384713..3384769 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3300545..3300601 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13873762..13873818 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8211067..8211123 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039801 (2410089E03Rik) RIKEN cDNA 2410089E03 gene Gene [Source:MGI Symbol;Acc:MGI:1920942]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3814784..3814840 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18500834..18500890 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3256631..3256687 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15115391..15115447 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031939 (Josd3) NM_029248 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, D Gene [Source:MGI Symbol;Acc:MGI:1922566]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8656253..8656309 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7388869..7388925 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040034 (Nup43) NP_663752 nucleoporin 43 Gene [Source:MGI Symbol;Acc:MGI:1917162]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273253..3273309 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4965686..4965742 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4252637..4252693 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5050124..5050180 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4896918..4896974 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8960313..8960369 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7259307..7259363 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4912917..4912973 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9764081..9764137 57
NO GENE  


Sequence tag IST10099A11HMF1
Sequence
CCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCT
Sequence Type genomic DNA
Unitrap ID UNI12847 UNI26052 UNI26585 UNI31091 UNI31848 UNI33283 UNI33422 UNI33423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9764081..9764137 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7388869..7388925 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040034 (Nup43) NP_663752 nucleoporin 43 Gene [Source:MGI Symbol;Acc:MGI:1917162]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3256631..3256687 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18500834..18500890 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3814784..3814840 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8656253..8656309 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8211067..8211123 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039801 (2410089E03Rik) RIKEN cDNA 2410089E03 gene Gene [Source:MGI Symbol;Acc:MGI:1920942]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13873762..13873818 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3300545..3300601 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3384713..3384769 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3752002..3752058 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4912917..4912973 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8960313..8960369 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4896918..4896974 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5050124..5050180 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4965686..4965742 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4252637..4252693 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273253..3273309 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15115391..15115447 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031939 (Josd3) NM_029248 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, D Gene [Source:MGI Symbol;Acc:MGI:1922566]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 395433..395489 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053461 (Hhipl2) hedgehog interacting protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:1926022]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 182324..182380 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166291: 22519..22575 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7259307..7259363 57
NO GENE  

 
Come back to gene ENSMUSG00000079834


For any suggestions or comments, please send an email to unitrap@crg.es