Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14937C4
Clone ID IST14937C4
Vector VICTR76
Project tigm

Sequence tag IST14937C4HMR1
Sequence
ANNCCCCTGCNNGCTCCTTTTCTGCCTTGGAAGGGAGACGGACATTGACCATTATCCTGAGAGCTGCTAGCTTANGTCCT
GTTC
Sequence Type genomic DNA
Unitrap ID UNI7764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97668906..97668985 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


Sequence tag IST14937C4BBF1
Sequence
GTTAAGAGCACTGGCTACTTTTGCAGAGGACGTGGGTTCAGTTTGCAGCACCTACATCTAAGCTCACAACCACCTATAAC
TCCAATGACAAGGGATCTGATGCCCTTTCCTGGTCTCCATGGATATACCAGGCACACAAGTGGTACCCATACACACACGT
ACATAAAACATTCATACACCTAAAATAAATGTTTTGTATTCGCAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97668688..97668903 216
NO GENE  

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es