Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14914A2
Clone ID IST14914A2
Vector VICTR76
Project tigm

Sequence tag IST14914A2BBF1
Sequence
GTTGAGGTATGGAAGGTAGCCTTTGTTTTGAATTATTCAACAAAGCAACTACTAGTGTTTAGTGACAGAAAACCTCAGAC
TAAACTAGGAAGTGGTGTGGAAGTACAGTAATTAACATGGTGACTCAGGAGAAATGGCCTTACTCAAAATCACTGTGTCA
TTATCAACTTCTCTCCTAAGAGGAAAACTAATAGTAGAGATGTGTTAGATCCCATGGTTCAAGACTCTGTGCATGCTTTT
TTGAGTTTTGATGTCCTCTAGTCCCTGGGCAGGATTTGTGAGTAATAAGAGGGCTGCTTTCTGGCATCTCTTCATCTTGA
CACGGGTTGTACTAGCCCCTCTCTCCTGTCATGTACCTGTACCATCTAAAGGCGTATGGTCGCACAACCTCTGGTATGGG
GAAATCTGACAGGACAGTTTTCCAGTACAGTCTGAAGGAATACTGAGTCTAGTTCACTAGACCACTGAAACAATACACTG
CCGTCTCCATTTCCTTCAGCTTTTN
Sequence Type genomic DNA
Unitrap ID UNI15422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 145160529..145161032 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040370 (Lyrm5) NM_133688 LYR motif containing 5 Gene [Source:MGI (curated);Acc:Lyrm5-002]


Sequence tag IST14914A2HMR1
Sequence
CAACAGCTAANATAAAACAAATTTGAATTTATATGCAGTAGGTGTTAAGTTTTTATCTCATTACCAAGGTTCGGAGGGCA
GTAAGGTCTTAAGTGTTGTGCAACCAATGACCTTAACCCACAAAAACTAGCTGTCAGTCCTACTGAACAGAACATTTAGT
TTATGTAAGGGACAGAGCATTAGTACTCTATCTTGGGTTANACGGGCCGTAAGCTGGGGTTGGGTTAAAGAACTGTCTCC
ATTCCTCTACGTCTCANGTGCCTTTTCTTATGGAGAAGGGCTGAAATTCTGCAGGCTGCCACAACAGTACAGCGCTCCGT
GACCTTGGGACAACAATGGCTTACTGGTTCTTNNNAGTCNCGTTAAACTANTGTGTGAGCAGCTCTTGANAANGNCNAAT
GCNTNNCNTANAANCTAAACTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14914A2HMF1
Sequence
GTTGAGGTATGGAAGGTAGCCTTTGTTTTGAATTATTCAACAAAGCAACTACTAGTGTTTAGTGACAGAAAACCTCAGAC
TAAACTAGGAAGTGGTGTGGAAGTACAGTAATTAACATGGTGACTCAGGAGAAATGGCCTTACTCAAAATCACTGTGTCA
TTATCAACTTCTCTCCTAAGAGGAAAACTAATAGTAGAGATGTGTTAGATCCCATGGTTCAAGACTCTGTGCATGCTTTT
TTGAGTTTTGATGTCCTCTAGTCCCTGGGCAGGATTTGTGAGTAATAAGAGGGCTGCTTTCTGGCATCTCTTCATCTTGA
CACGGGTTGTACTAGCCCCTCTCTCCTGTCATGTACCTGTACCATCTAAAGGCGTATGGTCGCACAACCTCTGGTATGGG
GAAATCTGACNGGACAGTTTTCCAGTNCAGTCTGNNNAATACTGAGTCTAGTTCACTAGANCNNTGN
Sequence Type genomic DNA
Unitrap ID UNI15422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 145160529..145160989 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040370 (Lyrm5) NM_133688 LYR motif containing 5 Gene [Source:MGI (curated);Acc:Lyrm5-002]

 
Come back to gene ENSMUSG00000040370


For any suggestions or comments, please send an email to unitrap@crg.es