Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11683H5
Clone ID IST11683H5
Vector VICTR76
Project tigm

Sequence tag IST11683H5HMF1
Sequence
NAACAACAGTCTCCGCAGTCCGCTCTCCANCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11683H5HMR1
Sequence
NGGGTTCTCAGGGACATGCACGAAGTTAATCCCTACTTCTAAGGCAATCATCGAAGCANAGCGGATCCATGCTTCAGAAG
TGCTCACAGTGGGGACCCCTCCGCCGAGGGTACTCCCTACTTCTGGGCGCTCACAGTGAGTGTCTTTTTTCTTANCGGCG
TATGGTGTGGACCCAGCTCTGAACTTCGGCGGAGGGGATTTCTGCCGCCGGANAANGGACCCCTATTCCTCCCAACCCCG
AATCCTGTTTACCCNATGCCTTGTTATGGGTTANNTNTTCCGGTAAGGGATGGGGGAAGTTNNANGCTNNTNAN
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443995..180444301 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es