Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12243G2
Clone ID IST12243G2
Vector VICTR76
Project tigm

Sequence tag IST12243G2HMF1
Sequence
NCATANCCTGTTGGANGATGACTGTATAATGTAGTGGTGAACGGAGACATGATACTGTGTTTTGTAACCTTGGGCAGGAG
AAGGAAAATTAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI26806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40548267..40548362 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]


Sequence tag IST12243G2BBF1
Sequence
GCATAGCCTGTTGGAGGATGACTGTATAATGTAGTGGTGAACGGAGACATGATACTGTGTTTTGTAACCTTGGGCAGGAG
AAGGAAAATTAGTCAACAGCTAATTGGATATCAATTTCTGCAACATGTGATTTGAACCTTTTTAAGAAACTGGCCTTTTC
TAGTGCCAGCTTCTCAAAAGAGATTGAACTAGCTTTAATAACATTGAGTTTAAAAGAGAGAGCACTTTTAAGGCAGGTGT
TGTGGTGCACGCTTTTAATCCCAGCATTTGGGAACCTTAGGCAGGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI26806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40548266..40548557 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es