Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14646B1
Clone ID IST14646B1
Vector VICTR74
Project tigm

Sequence tag IST14646B1HMR1
Sequence
TACATTAAATGCTAAGAACTCAATGTCTTTGCACTGAATTAAACATACAGCAGAGAACTATAATGCAAGCTTTCCCGCTG
AGTTTGTAAAAGGCTCATTAAGAGCTGGGTGTGGGAGAAGACTGTGTCTGTCTCTCCACTCCCATATTATTCCTGTGGGT
TCTAGGGGCTTACTTTGCATTGTACTCTGGTGACCTGTCTCTTCCACTGGATGCAAANATCCNTTTGTCTTCTANAAAAG
AGGCTGTCTGAGTCAGTTTCCTAATGAGAGCTATAATTTGGGAGTGGAGATGGAGCTATTTTGGAGGAACGCGGGCCTCT
GAAAGATGTGGTTTGGGTGGTTCNCNANNAN
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368568..110368910 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]


Sequence tag IST14646B1HMF1
Sequence
TACATAAGCAAGGAACATATTTGTATGTACAGAGTCCAATTACAGCTCACGTAGCTTTCTGTGGCTAGCACAACTGCCCT
GGAACCCCCCACGGTCACCACAACAAACATGTCCAGATGGCTGCCAAGTAAGTTGCTGTGCGCTTCACTAACCCCCAAAG
CCCCTAGTCCCGCCAACAGTTGGTGTTCCCACTCAGCCAGGTTTGTCAGGCCTACAGAAAACGCTATCAAGTCCCCTTCT
CTGCAGTGACTGTCATGGTATGTGGGGACAGTCTCCAAACATGGTCTGATGTGATGTGAAATCCCAGACTATCTATGATG
TAGGGGCAACATTCGCTAATTCCCCTTAACAAACCGGCCTCCCGGGACAGCTTAACTGGCTGATTTCGGAATGTCNGCGT
TCTCAACTGCCTGANCAAGCCAGCCGGCTAANAAGGGACCTTGTTTCTGTGGTCTACTCCNTTTCCCCCTAACACCGATT
TTTGGGCTTCCCTTCTGTGAGGGGTATTTGCNNCNNTTGCCTGNTNANTTTCNGGANGTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368031..110368569 513
NO GENE  


Sequence tag IST14646B1BBF1
Sequence
TACATAAGCAAGGAACATATTTGTATGTACAGAGTCCAATTACAGCTCACGTAGCTTTCTGTGGCTAGCACAACTGCCCT
GGAACCCCCCACGGTCACCACAACAAACATGTCCAGATGGCTGCCAAGTAAGTTGCTGTGCGCTTCACTAACCCCCAAAG
CCCCTAGTCCCGCCAACAGTTGGTGTTCCCACTCAGCCAGGTTTGTCAGGCCTACAGAAAACGCTATCAAGTCCCCTTCT
CTGCAGTGACTGTCATGGTATGTGGGGACAGTCTCCAAACATGGTCTGATGTGATGTGAAATCCCAGACTATCTATGATG
TANGGGCAACATTCGCTAATTCCCCTTAACAAACCGGCCTCCCGGGACAGCTNAACTGGCTGATTTCGGAATGTCAGCGT
TCTCAACTGCCTGANCAAGCCNNCCGGCTAANANGGACCTTGTTTCTGTGGTCTACTCCCTTTCCCCCTAACACCGATTT
TTGGGCTTCCCTTCNGTNANGGNTATTTGCNNCCTTTGCCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110368046..110368569 494
NO GENE  

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es