Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_338F2-3
Clone ID CMHD-GT_338F2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_338F2-3
Sequence
GAATGAAGTTGGGCCTCTGCCATCTGATTTTCTGTGTTCTCAATAAATGTTGGGTTTGGC
Sequence Type mRNA
Unitrap ID UNI12889

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35050931..35050989 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013787 (Ehmt2) NM_145830 euchromatic histone lysine N-methyltransferase 2 Gene [Source:MGI (curated);Acc:Ehmt2-003]

 
Come back to gene ENSMUSG00000013787


For any suggestions or comments, please send an email to unitrap@crg.es