Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13950E1
Clone ID IST13950E1
Vector VICTR74
Project tigm

Sequence tag IST13950E1HMF1
Sequence
CAGCATAGTCCTCAAATCCAGGCGGGAGCCGTCCCCCGCACCTTCGGCTCCCANANTTANTANCTCTCGAAACCCTANCC
GCGCCCCCCCTTGCCCTTTANTCTCANATCCNCGCGGGAAANACTCTCGTGGGGTGGGGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13950E1BBF1
Sequence
CAGCATAGTCCTCAAATCCAGGCGGGAGCCGTCCCCCGCACCTTCGGCTCCCAGATTTAGTAGCTCTCGAAACCCTAGCC
GCGCCCCCCCTTGCCCTTTAGTCTCAGATCCACGCGGGAAAGACTCTCGTGGGGTGGGGCCGCGGANCNGTGCNCCNGCN
CNNNGNCNNCAA
Sequence Type genomic DNA
Unitrap ID UNI31284

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69360106..69360264 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005237 (Dnahc2) NM_001081330 dynein, axonemal, heavy chain 2 Gene [Source:MGI (curated);Acc:Dnahc2-001]

 
Come back to gene ENSMUSG00000005237


For any suggestions or comments, please send an email to unitrap@crg.es