Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_339H7-3
Clone ID CMHD-GT_339H7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_339H7-3
Sequence
ACGGAGTGGTTCAACCATTATAAAAAGTCTCTTGCTACATACATGAGGTCACGTGGGAGGAGATGAAGGCTTGGACATCA
CACAAGATGTGAAGCCCCCCAAAAGCCTATATCTTGAAGTGCGGTGTTTAAAAGACTATGGAGAATTTGAAGTTGATGAT
GGCACTTCAGGCCTGCTTAAAAAAAATAATCAGCACTTTTTGCCTCGGTGGATGTGTGACCACTTAATTAGATAAGGAGT
TCTAGACCAGGTGCTGTCCTGACTGTGTCCTGGGGGGACAGCAGCTGGATGTAAAGCTAAGCCAACTCTCAGAAGGAAAC
GTCCTCCCTGCACCTCCCCCTCCTTGGTTTTAAATTGAAAGACATGCATTAACATAACCAAGATGGGCTGGGGTCCAACT
CATTGGTAGAGCACCTGCTTAGGATTTGAGAAACCCATAGTTTCTTCCCTAGTACCTCAAGAAACAAGACAAAAAAAATC
AAAGACAAAACCATGAACTCTTGGCTAGGAGCATAATCTGCCAGCTCTTAAGCCTTTGTTACAGGTTATATCTCTAGTTA
TTCCATTCCCACAGTAATATTGTACTCTTATAATTGAAAATAAACAGTCTTTGGTTTG
Sequence Type mRNA
Unitrap ID UNI12899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150751618..150757001 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027454 (Gins1) GINS complex subunit 1 (Psf1 homolog) Gene [Source:MGI (curated);Acc:Gins1-001]

 
Come back to gene ENSMUSG00000027454


For any suggestions or comments, please send an email to unitrap@crg.es