Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508A6
Clone ID IST14508A6
Vector VICTR74
Project tigm

Sequence tag IST14508A6HMR1
Sequence
CCTTTANACCTGCAGGGTTTTGCTTTTTAAGTACAAAATGAGGAAGTTGGATCTTTGATTTTTAAGGTATCTTTGANCAT
TANAATTGTGGGTCAATTTTCTTTTTTGTAATAGTGTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29139495..29139628 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


Sequence tag IST14508A6BBF1
Sequence
AGGTTTGTAAAATGTTTTTCTTCTTAAATTTAAAATCTCATTTCCTACCACATTAACCTATACTTGGCTTATTGTTAGAC
AAACTAAACTGCTCCAGCATAAGTGACCGAATTCAAAAGTTTGTCCTTAGCCAGCTTTCTTTTGTGTAAAATCAATGAAT
TTACTTCCTCCACCTCCCTCCCTANTGGAATTTTTTTTGATATGGTGTGACTGCGTAGCCCACACTGGCCTANAACNNNN
NNNNNNNNNNNNNCCAAATGCTGTGGTTACAGGTGTGTACCTCCNTGCCTAATGGGTTCTGTCCTTTTACCCCNACNGGA
ANTANANCAAANTTNNGGAGGAGCAGAAAGCCATTTTCTTTTTTTTTCNNNNNNNGGTTTCTCNNTGTAGGCCTGGCTGT
CCTGGAACTNNNTCTGTNNACCANGCTGACCTCNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29139626..29140058 232
 
EST/CDNA Est Name
  BY173763.1 - BY788050.1 - BY789770.1 - BE375812.1 - BY325065.1 - BY785030.1 - BY326873.1 - BY139668.1 - BQ877460.1 - BY768786.1 - BY057134.1 - BY048443.1 - BY048428.1

 
Come back to gene BY173763.1 - BY788050.1 - BY789770.1 - BE375812.1 - BY325065.1 - BY785030.1 - BY326873.1 - BY139668.1 - BQ877460.1 - BY768786.1 - BY057134.1 - BY048443.1 - BY048428.1


For any suggestions or comments, please send an email to unitrap@crg.es