Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14665G10
Clone ID IST14665G10
Vector VICTR74
Project tigm

Sequence tag IST14665G10HMF1
Sequence
CTACAAAGTCCTCTGGAGGCTCCTAANCAAATCANAATCACTGATTTAAAAAACTTATGATAGCTATTATTGCAAAGCTT
TCCTTTTGGGCATTTTCTTTTTACTTATTTTTCTTTCAGTTTTCAGAGACAAGGATCTCTGTATAGCTAGTCCTGGCTGT
CTTGGAGCTCACTTGTAGACCACACTGGCCTTGAACTCANATCTACCTGTCTCTGCCTCCTGANCACTGGGATCAAAGGT
GTGCGCCACCAGGCATGGCTGGGTCTTTGTTCANCTCATGGGAGGAATAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62244635..62244926 282
 
EST/CDNA Est Name
  AI465804.1 - BY335769.1 - BY329982.1


Sequence tag IST14665G10HMR1
Sequence
NGTCTCAAATTAGACCTAGCGTANAGTAGGTTTTTGTTGGAAAATAATTTCTTTAGCTTCTCACCCTGTCTGTTGTGTTG
AATAGCAGTTCCATGCTGATTCATACTTTTAAATGTCCCAAGTATCCANATCTCTAACAGCCCAGCCCAGTTGTTACTAC
TGAATATATACAAAAGGATANTTGCATCAATTTTTTAGTTCCCCTTAATAATGACTTGCATTTTTATTTTTTATTTTATT
TACATATTTTGTTTAGTATTTCAAGACAGGTTTCTGTCCTGGAACCTGATCTGTAGACNAGGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102829354..102829660 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es