Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_339E9-3
Clone ID CMHD-GT_339E9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_339E9-3
Sequence
GTGGGATGTGTGTGGGCTGAAATCCCAAGCTGCGGTTGTGCATGAGAATACACCCTTCGTGGTGCCCCATCTCCGGGACG
TTCTCGGCTCTGTGCATTCAGTCCCCAGGAACCGTGGACCTTAATTTACCTTGTTAAGTTCTTTCTCTTTCCTATTCTCT
CTCCTGCTCAATTTCCTGTTCTCCTGTTTGCTCTTCTGTAGCTTCCCCTTTGAGTTCTGCTCTCCCAGCATGCCTCCTAT
GCAGAAACCGGTGGGGCTGTGCTGTCTCCTCCCTTCCTCCTGACTGCAGTCAGTGGGTATTGGATTTGGGAGTGACCTTG
TTGAGAATCACTGCTCCTAGTTTTCTATTTTGGCCCAAAGACTAGACTTAAAAATTTGGAGCACCTTCCAGTGAAATAAA
TGGTTTTTCAAATT
Sequence Type mRNA
Unitrap ID UNI12904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4785154..4785567 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es