Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11263E11
Clone ID IST11263E11
Vector VICTR76
Project tigm

Sequence tag IST11263E11HMR1
Sequence
NNTAAAGAGCATGGCCTCTTAAAAGAGCAGTAACGGGCTGGAGAAATGGCTCAGTGGTTAAGAGCACCGGCTGCTCTTCC
AGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCATAACCATCTCTAATAGGATCTGATGCCCTCTTCTGGTG
TGTCTGAAGATGGCTACAGTGTACTCACATAAAATAAACAAATCTAAAAAAAAGAAAAAAAAAGAGCANTANCATCATAT
ATACNGTTCTGTAACTTACGGCTCTTATTTAAN
Sequence Type genomic DNA
Unitrap ID UNI32608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30737939..30738208 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST11263E11BBF1
Sequence
NNTGAGCACATAAATGTACNCGTTCATGCTCACGAGTGTAAAGAAGTCAATTTGTCAGGANCTGNATGACTGACTAGGAG
AAATAAATAATTTTTAGTCTTTGGGCTTTTCTGTATCTTGCTATTTGGGAAATGGAGTTGGGCTGCAAGGCAAATGAATT
TCGCCTGTCATGTACACAANACAGTTTGTCAATACAGGAAAATANTCNAGTCCTGGANATACTGATGCTTNATATAAAAA
TATTTTNNATTATTATAAACGGCTAAAGGTAGCACTCGTTCAAACGCGGTCTTCACACATCTCCACACAATCCTACCCGC
CTAACTTCCACCNANNNAGTTTTTNATTAATGCATTCATTCATNATCTCAGCCNTCACATGTGCNCNNNCNTNNGTAAAG
GCACATNANAGGATAACGAGCAAATTATAGTCNCATNANNGCTGNTGCAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11263E11HMF1
Sequence
ATATGAGCACATAAATGTACGCGTTCATGCTCACGAGTGTAAAGAANTCAATTTGTCAGGANCTGCATGACTGACTAGGA
GAAATAAATAATTTTTAGTCTTTGGGCTTTTCTGTATCTTGCTATTTGGGAAATGGAGTTGGGCTGCAAGGCAAATGAAT
TTCGCCTGTCATGTACACAANACAGTTTGTCAATACAGGAAAATANTNNNGTCCTGGANATACTGATGCTTCATATAAAA
ATATTTTCAATTATTATAAACGGCTAANGGTAGCACTCGTTCAAACGCGGTCTTCACACATCTCCNCACAATCCTACCCG
CCTAACTTCCACNCACAGAGTTTTTNATTAATGCATTCATTCNTTATCTCAGCNNTCACATGTGCACCCACGTTCGTAAA
GGCACATAAAGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30738208..30738620 383
 
EST/CDNA Est Name
  BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1

 
Come back to gene BB621686.1 - BE534724.1 - BY165308.1 - BY159855.1 - BY308145.1 - BY170150.1 - BY163939.1


For any suggestions or comments, please send an email to unitrap@crg.es